- StudyBlue
- Ohio
- Miami University of Ohio
- Zoology
- Zoology 232
- Rypstra
- druid_dracula_clicker.ppt
druid_dracula_clicker.ppt
Zoology 232 with Rypstra at Miami University of Ohio
About this note
About StudyBlue
STUDYBLUE makes things that make you better at school.
Things like online flashcards with photos and audio.
Things like personalized quizzes and friendly reminders about when (and what) to study next.
Think of it as a digital backpack™: access to all of your study materials online and on your phone.
STUDYBLUE exists to make studying efficient and effective for every student, for free. Join us.
“Simply amazing. The flash cards are smooth, there are many different types of studying tools, and there is a great search engine. I praise you on the awesomeness.”
Dennis
Dennis
Sign up (free) to study this.
* The Case of the Druid Dracula: Clicker Case Version Adapted from Brickman (2004). The Case of the Druid Dracula. National Center for Case Study Teaching in Science, University at Buffalo, State University of New York. by Norris Armstrong, Terry Platt, and Peggy Brickman * The Crime In a quiet corner of Wales in the village of Llanfairpwll, 90-year-old Mabel Leyshorn was murdered. Her murder had been not only brutal (her heart had been hacked out), but also creepy. It appeared as if the Mabel?s blood had been collected in a small kitchen saucepan and tasted. The murder showed other signs of the occult: a candlestick and a pair of crossed pokers had been arranged near the body. - from BBC?s Crimewatch December 2001 * The Crime Scene Further investigation indicated that this was no supernatural villain at work: the murderer had worn tennis shoes which had left distinctive footprints under the glass door that had been shattered by a piece of broken garden slate. Moreover, the windowsill had bloodstains on it; with any luck, the evidence recovery unit hoped to use it to help determine who had committed the crime. * CQ1: What is your blood type? A: A B: B C: AB D: O E: Don?t know * Evidence in the Courtroom Primarily rape cases Paternity testing Historical/missing persons investigations Military ?dog tag? Convicted felon databases Sources of DNA? Blood was previously used for blood typing Now used as source of DNA Uses for DNA fingerprinting * DNA in the Cell Target Gene chromosome double stranded DNA molecule individual nucleotides * Example: Amelogenin Gene Tooth enamel development Copies on X and Y chromosome X copy is different from Y copy Y: X: --- indicates missing bases X copy is shorter than Y copy 5?CCCTAGGGTCTA---------GTGTGTTGATTC 5? 3?GGGATCCCAGAT---------CACACAACTAAG 3? GTGTGTTGATTC 3? CACACAACTAAG 5? 5?CCCTAGGGTCTATAACGCCTAGTGTGTTGATTC 5? 3?GGGATCCCAGATATTGCGGATCACACAACTAAG 3? * Gel Electrophoresis: Sizing DNA Fragments (-) Negative electrode (+) Positive electrode bp? bp? * CQ2: The DNA fragment indicated is approximately ____ base pairs in size. bp? A: 300 B: 350 C: 580 D: 600 E: 700 * Why do the two DNA fragments indicated differ in how bright they appear? * Antiparallel Complementary DNA Structure Two DNA chains 5? end 3? end 5? end 3? end * CQ3: Below is one strand from part of the amelogenin gene. What is the nucleotide sequence of the other strand? A: 3? -ACTGTTAGATT-5? B: 3? -GGGACCCGAGA-5? C: 5? -GGGACCCGAGA-3? D: 3? -CCCTGGGCTCT-5? E: 5? -CCCTGGGCTCT-3? 5?-CCCTGGGCTCT-3? * Copying DNA (Replication) A T C G G A C T T A G C C T G A - - - - - - - - DNA strands are separated Each single strand is used as a template to make a complementary strand Two identical DNA molecules are produced A T C G G A C T T A G C C T G A - G A - T - T - C - A - A T C G G A C T - - - - - - - - T A G C C T G A - - - - - - - - Enzymes Perform Replication Helicases unwind DNA double helix. Single Stranded Binding Proteins hold separated DNA strands apart. Primase makes a starting point (primer). DNA polymerase connects new complementary bases. Ligase attaches pieces together. * * Enzymes Perform Replication Replication fork * CQ4: How would DNA replication be affected if ligase were not available? A: The template strands would not be able to separate. B: Replication would result in many small segments of DNA instead of a complete molecule. C: Complementary RNA would be produced but not complementary DNA. D: The DNA strands would separate but replication would not be able to start. E: The DNA strands produced by replication would not be complementary to the template strands. * In 32 cycles at 100% efficiency, 1.07 billion copies of targeted DNA region are created Amplifying DNA with PCR (Polymerase Chain Reaction) Target region Thermal cycle Thermal cycle Thermal cycle * CQ5: You need many copies of the amelogenin gene, which you will make using Polymerase Chain Reaction (PCR). You will need to follow the steps of replication. Which of the following would allow you to begin? A: Add short stretches of single stranded DNA complementary to the sequence at either end of the gene. B: Add DNA polymerase enzyme. C: Break the covalent bonds that hold the double helix together. D: Break the hydrogen bonds that hold the double helix together. * CQ6: Which of the strands of DNA could act as a primer for the DNA sequence shown below? 5?-CCCTGGGCTCTGTAAATGTTTCTAAGTG-3? 3?-GGGACCCGAGACATTTACAAAGATTCAC-5? A: 3? -ACTGTTAGA-5? B: 3? -AAATTTGGC-5? C: 3? -ATGCTTTGA-5? D: 5? -GGGACCCGA-3? E: 5? -CCCTGGGCT-3? * Automated gels MW Amelog. 101 bp 110 bp * CQ7: The blood left at the crime scene was from a male. Which of the following DNA profiles could have come from the suspect? A: B: * CQ8: Is this enough to convict a suspect? A: Yes B: No * Additional Markers ---TCAT--- ---TCAT--- Short Tandem Repeats (STRs) Same pair in suspect 2: Different people have different numbers of repeats on their chromosomes Chromosomes 11 of suspect 1: * Positions of other STR regions CSF1PO TH01 TPOX AMEL Each person is unique * Druid Dracula: DNA testing With kits just add DNA sample with primers for amelogenin (XY) different STR regions. Amplify and electrophores. Allele ladder shows all varieties in population. * * CQ9: What is the chance that someone might have 5 and 7 repeats for the STR THO1 just by accident? STR THO1 allele frequencies 5 6 7 8 9 9.3 10 1/200 1/4 1/6 1/7 1/6 1/3 1/100 A: 1/200 B: 1/206 C: 1/600 D: 1/1200 E: 1/2600 * Hardman?s Arrest Standard police work identified Matthew Hardman as a suspect. Preliminary DNA testing provided enough evidence to arrest Hardman on suspicion of murder. During the arrest, a knife was found in his coat pocket. Subsequent DNA testing revealed two sources of DNA on the knife, one from Hardman and one matching the victim. The possibility of a random match was one in 73 million. A search of Hardman?s dwelling produced magazines and evidence of accessing internet sites featuring how to become a vampire. Matthew Hardman was found guilty of murder on August 2, 2002, and sentenced to life imprisonment.
Back
Next
About this note
About StudyBlue
STUDYBLUE makes things that make you better at school.
Things like online flashcards with photos and audio.
Things like personalized quizzes and friendly reminders about when (and what) to study next.
Think of it as a digital backpack™: access to all of your study materials online and on your phone.
STUDYBLUE exists to make studying efficient and effective for every student, for free. Join us.
“Simply amazing. The flash cards are smooth, there are many different types of studying tools, and there is a great search engine. I praise you on the awesomeness.”
Dennis
Dennis